pCAG-EGFP-C-IFT81
(Plasmid
#218732)
-
PurposeExpresses N-terminally EGFP-tagged IFT81 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218732 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAG-EGFP-C
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6767
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFT81
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2031
-
Entrez GeneIFT81 (a.k.a. CDV-1, CDV-1R, CDV1, CDV1R, DV1, SRTD19)
- Promoter CAG
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTGAGCAAAGACCCCAACGAG
- 3′ sequencing primer GCCAGAAGTCAGATGCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-EGFP-C-IFT81 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218732 ; http://n2t.net/addgene:218732 ; RRID:Addgene_218732)