pEGFP-C1-IFT27
(Plasmid
#218722)
-
PurposeExpresses N-terminally EGFP-tagged IFT27 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218722 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFT27
-
SpeciesH. sapiens (human)
-
Insert Size (bp)186
-
Entrez GeneIFT27 (a.k.a. LL22NC01-132D12.2, BBS19, RABL4, RAYL)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII/BamHI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTGAGCAAAGACCCCAACGAG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-IFT27 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218722 ; http://n2t.net/addgene:218722 ; RRID:Addgene_218722) -
For your References section:
Overall architecture of the intraflagellar transport (IFT)-B complex containing Cluap1/IFT38 as an essential component of the IFT-B peripheral subcomplex. Katoh Y, Terada M, Nishijima Y, Takei R, Nozaki S, Hamada H, Nakayama K. J Biol Chem. 2016 Mar 15. pii: jbc.M116.713883. 10.1074/jbc.M116.713883 PubMed 26980730