Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-N2-IFT20
(Plasmid #218719)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218719 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-N2
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4723
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IFT20
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    132
  • Entrez Gene
    IFT20
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII/BamHI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N2-IFT20 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218719 ; http://n2t.net/addgene:218719 ; RRID:Addgene_218719)
  • For your References section:

    Overall architecture of the intraflagellar transport (IFT)-B complex containing Cluap1/IFT38 as an essential component of the IFT-B peripheral subcomplex. Katoh Y, Terada M, Nishijima Y, Takei R, Nozaki S, Hamada H, Nakayama K. J Biol Chem. 2016 Mar 15. pii: jbc.M116.713883. 10.1074/jbc.M116.713883 PubMed 26980730