pEGFP-C1-BBS18
(Plasmid
#218718)
-
PurposeExpresses N-terminally EGFP-tagged BBS18 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218718 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBBS18
-
SpeciesH. sapiens (human)
-
Insert Size (bp)276
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII/BamHI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTGAGCAAAGACCCCAACGAG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-BBS18 was a gift from Kazuhisa Nakayama (Addgene plasmid # 218718 ; http://n2t.net/addgene:218718 ; RRID:Addgene_218718) -
For your References section:
Multisubunit complex architectures revealed by visible immunoprecipitation (VIP) assay using fluorescent fusion proteins. Katoh Y, Nozaki S, Hartanto D, Miyano R, Nakayama K. J Cell Sci. 2015 May 11. pii: jcs.168740. 10.1242/jcs.168740 PubMed 25964651