pFB-6HZB
(Plasmid
#218680)
-
Purpose(Empty Backbone) Expression of Z-tagged proteins using Baculoviruses
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218680 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFB-6HZB
-
Backbone manufacturerPravin Mahajan, SGC
-
Vector typeInsect Expression ; pFB
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- His-Z-TEV (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TATTCATACCGTCCCACCA
- 3′ sequencing primer GGGAGGTTTTTTAAAGCAAGTAAA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPravin Mahajan, SGC
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.12.23.573181v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB-6HZB was a gift from Sebastian Mathea (Addgene plasmid # 218680 ; http://n2t.net/addgene:218680 ; RRID:Addgene_218680)