pJK2097
(Plasmid #218665)

• Purpose: Expression of MBP:6xHIS:FBF-2(Y479A, 121-632)
• Depositing Lab: Judith Kimble
• Publication: Carrick et al Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. Epub 2024 Jan 29.

Backbone

• Vector backbone: pHMTc
• Backbone size w/o insert (bp): 7688
• Total vector size (bp): 8199
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: fbf-2
• Alt name: pHMTc-FBF-2 (121-632) Y479A
• Species: C. elegans (nematode)
• Insert Size (bp): 510
• Mutation: amino acids 121-632 only, with Y479A mutation
• Entrez Gene: fbf-2 (a.k.a. CELE_F21H12.5)
• Tag / Fusion Protein:
  • MBP-6xHIS (N terminal on insert)

Cloning Information

• Cloning method: Other
• 5′ sequencing primer: tggactcaagacgatagttaccggataagg
• 3′ sequencing primer: gtccggatgtggaatTGCtccgtcgaaaat

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry