Skip to main content
Addgene

pHMTc-FBF-2 (121-632)
(Plasmid #218664)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218664 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pHMTC
  • Backbone size w/o insert (bp) 7688
  • Total vector size (bp) 8199
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    fbf-2
  • Alt name
    BH97
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    511
  • Mutation
    amino acids 121-632 only
  • Entrez Gene
    fbf-2 (a.k.a. CELE_F21H12.5)
  • Tag / Fusion Protein
    • MBP-6xHIS (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Eco RI (unknown if destroyed)
  • 3′ cloning site Sal I (unknown if destroyed)
  • 5′ sequencing primer gtcgcaaattgtcgcggcga
  • 3′ sequencing primer tcgccgcgacaatttgcgac
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHMTc-FBF-2 (121-632) was a gift from Judith Kimble (Addgene plasmid # 218664 ; http://n2t.net/addgene:218664 ; RRID:Addgene_218664)

  • For your References section:

    PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans. Carrick BH, Crittenden SL, Chen F, Linsley M, Woodworth J, Kroll-Conner P, Ferdous AS, Keles S, Wickens M, Kimble J. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. Epub 2024 Jan 29. 10.1016/j.devcel.2024.01.005 PubMed 38290520
Related items: