Halo-BASU-His
(Plasmid
#218451)
-
PurposeE coli expression vector for Halo-BASU-His biotin ligase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218451 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMG211
- Backbone size w/o insert (bp) 4540
- Total vector size (bp) 6268
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloTag-BASU-His fusion protein
-
SpeciesBacillus subtilis, Rhodococcus rhodochrous
-
Insert Size (bp)1728
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCGGATAACAATTCCCCTCTAG
- 3′ sequencing primer CAAGACCCGTTTAGAGGCCCCAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Halo-BASU-His was a gift from Thorsten Stafforst (Addgene plasmid # 218451 ; http://n2t.net/addgene:218451 ; RRID:Addgene_218451) -
For your References section:
Profiling the interactome of oligonucleotide drugs by proximity biotinylation. Hanswillemenke A, Hofacker DT, Sorgenfrei M, Fruhner C, Franz-Wachtel M, Schwarzer D, Macek B, Stafforst T. Nat Chem Biol. 2024 Jan 17. doi: 10.1038/s41589-023-01530-z. 10.1038/s41589-023-01530-z PubMed 38233583