pcDNA5_NLS-Halo-eGFP-BioID
(Plasmid
#218448)
-
Purposeexpresses the NLS-Halo-eGFP-BioID fusion protein via stable Flp-In integration
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA5
- Backbone size w/o insert (bp) 5084
- Total vector size (bp) 7709
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNLS-Halo-eGFP-BirA
-
SpeciesE. coli, Rhodococcus rhodochrous, Aequorea victoria
-
Insert Size (bp)2625
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer TTAAGCTTGGTACCGAGCTCGGATCC
- 3′ sequencing primer GATGGCTGGCAACTAGAAGGCACAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5_NLS-Halo-eGFP-BioID was a gift from Thorsten Stafforst (Addgene plasmid # 218448 ; http://n2t.net/addgene:218448 ; RRID:Addgene_218448) -
For your References section:
Profiling the interactome of oligonucleotide drugs by proximity biotinylation. Hanswillemenke A, Hofacker DT, Sorgenfrei M, Fruhner C, Franz-Wachtel M, Schwarzer D, Macek B, Stafforst T. Nat Chem Biol. 2024 Jan 17. doi: 10.1038/s41589-023-01530-z. 10.1038/s41589-023-01530-z PubMed 38233583