pXDC61-FabI
(Plasmid
#21842)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21842 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepXDC61
- Backbone size w/o insert (bp) 9869
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namefabI
-
SpeciesL. pneumophila
-
Insert Size (bp)810
-
GenBank IDgi3078106
-
Tag
/ Fusion Protein
- TEM (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GAGCTGTTGACAATTAATCATCGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXDC61-FabI was a gift from Howard Shuman (Addgene plasmid # 21842 ; http://n2t.net/addgene:21842 ; RRID:Addgene_21842) -
For your References section:
Chemical genetics reveals bacterial and host cell functions critical for type IV effector translocation by Legionella pneumophila. Charpentier X, Gabay JE, Reyes M, Zhu JW, Weiss A, Shuman HA. PLoS Pathog. 2009 Jul . 5(7):e1000501. 10.1371/journal.ppat.1000501 PubMed 19578436