1167A
(Plasmid #218233)

• Purpose: HDR plasmid for inserting Ceratitis capitata transformer female intron into the white pupae gene
• Depositing Lab: Omar Akbari
• Publication: Engineered Genetic Sexing Strain for the Medfly via CRISPR Mediated Translocation of an Alternately Spliced Intron into a Dominant Visible Gene. (unpublished)

Backbone

• Vector backbone: PiggyBac
• Total vector size (bp): 9190
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: putative metabolite transport protein
• gRNA/shRNA sequence: gaacgtaaagcgattggtgaggg
• Species: C. capitata

Resource Information

• Supplemental Documents:
  • Vector 1167A= pBac-gypsy-WP-LHA-[TraF-intron]-RHA-Opie2-tTA[CcTraF]-3'Hsp.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry