Skip to main content
Addgene

GEARBOCS-SPARCL1-N-HATag
(Plasmid #218185)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218185 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    GEARBOCS 2.0
  • Vector type
    AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA
  • gRNA/shRNA sequence
    CGCTACAGTCCCCATTGCCG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Sparcl1 (a.k.a. Ecm2, Sc1, hevin, mast9)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.01.17.524433 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GEARBOCS-SPARCL1-N-HATag was a gift from Cagla Eroglu (Addgene plasmid # 218185 ; http://n2t.net/addgene:218185 ; RRID:Addgene_218185)
  • For your References section:

    GEARBOCS: An Adeno Associated Virus Tool for In Vivo Gene Editing in Astrocytes. Bindu DS, Tan CX, Savage JT, Eroglu C. bioRxiv. 2023 Jan 19:2023.01.17.524433. doi: 10.1101/2023.01.17.524433. Preprint. 10.1101/2023.01.17.524433 PubMed 36711516