Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET15b-RvLEAMshort
(Plasmid #218122)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218122 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET-15b
  • Backbone manufacturer
    Novagen/Millipore
  • Backbone size w/o insert (bp) 5708
  • Total vector size (bp) 6078
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RvLEAMshort
  • Alt name
    Group 3 late-embryogenesis abundant protein, LEAM
  • Species
    Ramazzottius varieornatus
  • Insert Size (bp)
    441
  • Mutation
    Truncated form (58-181aa)
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHIS (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET15b-RvLEAMshort was a gift from Ci Ji Lim (Addgene plasmid # 218122 ; http://n2t.net/addgene:218122 ; RRID:Addgene_218122)
  • For your References section:

    Small LEA proteins as an effective air-water interface protectant for fragile samples during cryo-EM grid plunge freezing. Abe KM, Lim CJ. bioRxiv [Preprint]. 2024 Feb 11:2024.02.06.579238. doi: 10.1101/2024.02.06.579238. 10.1101/2024.02.06.579238 PubMed 38370693