Skip to main content
Addgene

pMBS-1022
(Plasmid #218020)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 218020 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAGM1301
  • Backbone manufacturer
    Sylvestre Marillonnet (Addgene plasmid #47989)
  • Backbone size w/o insert (bp) 2845
  • Total vector size (bp) 2431
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    8xHis-SP20-1xHA-tag
  • Insert Size (bp)
    188

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer CAATACGCAAACCGCCTCTCC
  • 3′ sequencing primer AATAGGCGTATCACGAGGC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Level 0 MoClo Part Position B5, insert can be released via BsaI digest

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMBS-1022 was a gift from Michael Schroda (Addgene plasmid # 218020 ; http://n2t.net/addgene:218020 ; RRID:Addgene_218020)

  • For your References section:

    A Modular Cloning Toolkit for the production of recombinant proteins in Leishmania tarentolae. Hieronimus K, Donauer T, Klein J, Hinkel B, Spanle JV, Probst A, Niemeyer J, Kibrom S, Kiefer AM, Schneider L, Husemann B, Bischoff E, Mohring S, Bayer N, Klein D, Engels A, Ziehmer BG, Stiebeta J, Moroka P, Schroda M, Deponte M. Microb Cell. 2024 Apr 30;11:128-142. doi: 10.15698/mic2024.04.821. eCollection 2024. 10.15698/mic2024.04.821 PubMed 38799406
Related items: