pMBS-1125
(Plasmid
#217999)
-
PurposeStart-methionine
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217999 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAGM1276
-
Backbone manufacturerSylvestre Marillonnet (Addgene plasmid #47986)
- Backbone size w/o insert (bp) 2845
- Total vector size (bp) 2254
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameStart-Met
-
SpeciesSynthetic
-
Insert Size (bp)11
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CAATACGCAAACCGCCTCTCC
- 3′ sequencing primer AATAGGCGTATCACGAGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Level 0 MoClo Part Position B2, insert can be released via BsaI digest
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMBS-1125 was a gift from Michael Schroda (Addgene plasmid # 217999 ; http://n2t.net/addgene:217999 ; RRID:Addgene_217999) -
For your References section:
A Modular Cloning Toolkit for the production of recombinant proteins in Leishmania tarentolae. Hieronimus K, Donauer T, Klein J, Hinkel B, Spanle JV, Probst A, Niemeyer J, Kibrom S, Kiefer AM, Schneider L, Husemann B, Bischoff E, Mohring S, Bayer N, Klein D, Engels A, Ziehmer BG, Stiebeta J, Moroka P, Schroda M, Deponte M. Microb Cell. 2024 Apr 30;11:128-142. doi: 10.15698/mic2024.04.821. eCollection 2024. 10.15698/mic2024.04.821 PubMed 38799406