p1071-Lenti-Single loxP
(Plasmid
#217892)
-
Purpose(Empty Backbone) Lentiviral vector, entry vector for Lentiviral Switch-OVER
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217892 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUC19
-
Modifications to backboneThis plasmid must be used with p931-SWITCH-OVER insert: EF1a-Blasti or p944-SWITCH-OVER insert: EF1a-Puro. For further information please refer to Supplementary Figure 11 – Construction of Switch-OVER vectors, Chylinski, K., Hubmann, M., Hanna, R.E. et al. CRISPR-Switch regulates sgRNA activity by Cre recombination for sequential editing of two loci. Nat Commun 10, 5454 (2019). https://doi.org/10.1038/s41467-019-13403-y
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox, CRISPR
- Promoter hU6
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCATATACGATACAAGGCTGTTAGAGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p1071-Lenti-Single loxP was a gift from Ulrich Elling (Addgene plasmid # 217892 ; http://n2t.net/addgene:217892 ; RRID:Addgene_217892) -
For your References section:
CRISPR-Switch regulates sgRNA activity by Cre recombination for sequential editing of two loci. Chylinski K, Hubmann M, Hanna RE, Yanchus C, Michlits G, Uijttewaal ECH, Doench J, Schramek D, Elling U. Nat Commun. 2019 Nov 29;10(1):5454. doi: 10.1038/s41467-019-13403-y. 10.1038/s41467-019-13403-y PubMed 31784531
