p223-Pulse-Switch
(Plasmid
#217889)
-
Purpose(Empty Backbone) Lentiviral Pulse-Switch vector for sgRNA expression, Cas9 and sgRNA expression are mutual exclusive; blastiR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217889 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox, CRISPR
- Promoter hU6
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCATATACGATACAAGGCTGTTAGAGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p223-Pulse-Switch was a gift from Ulrich Elling (Addgene plasmid # 217889 ; http://n2t.net/addgene:217889 ; RRID:Addgene_217889) -
For your References section:
CRISPR-Switch regulates sgRNA activity by Cre recombination for sequential editing of two loci. Chylinski K, Hubmann M, Hanna RE, Yanchus C, Michlits G, Uijttewaal ECH, Doench J, Schramek D, Elling U. Nat Commun. 2019 Nov 29;10(1):5454. doi: 10.1038/s41467-019-13403-y. 10.1038/s41467-019-13403-y PubMed 31784531