pET28b-ptetO::bac::gfp
(Plasmid
#217882)
-
Purposeexpresses the bac-BGC in bacterial cells, produces bacillamide D
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217882 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28b-ptetO
- Backbone size w/o insert (bp) 6598
- Total vector size (bp) 16048
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrow in TB medium, grow at 37 °C until OD600=0.8, then induce with tetracycline and shake at 20°C
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameDehydrogenase
-
Alt nameSagB/ThcOx-family dehydrogenase
-
SpeciesBacillus cereus DSM 28590
-
Insert Size (bp)978
-
GenBank IDMBR9672240.1
- Promoter ptetO
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCGACCTCATTAAGCAGC
- 3′ sequencing primer TGACGACAAGACCTACGTTCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNon-ribosomal peptide synthetase
-
SpeciesBacillus cereus DSM 28590
-
Insert Size (bp)7017
-
GenBank IDWP_048558486.1
- Promoter ptetO
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTGCTATCACGGATTACGAAG
- 3′ sequencing primer AAATGAGGATGATCCACATGAG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameAminotransferase
-
Alt nameaminotransferase class I/II-fold pyridoxalphosphate-dependent enzyme
-
SpeciesBacillus cereus DSM 28590
-
Insert Size (bp)1455
-
GenBank IDWP_000162820.1
- Promoter ptetO
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCTGCCCAATTAGGAATTGTTAC
- 3′ sequencing primer TTACCGTTGGTCGCATCACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28b-ptetO::bac::gfp was a gift from Tobias A. M. Gulder (Addgene plasmid # 217882 ; http://n2t.net/addgene:217882 ; RRID:Addgene_217882) -
For your References section:
Bacillamide D produced by Bacillus cereus from the mouse intestinal bacterial collection (miBC) is a potent cytotoxin in vitro. Hohmann M, Brunner V, Johannes W, Schum D, Carroll LM, Liu T, Sasaki D, Bosch J, Clavel T, Sieber SA, Zeller G, Tschurtschenthaler M, Janssen KP, Gulder TAM. Commun Biol. 2024 May 28;7(1):655. doi: 10.1038/s42003-024-06208-3. 10.1038/s42003-024-06208-3 PubMed 38806706