Skip to main content
Addgene

mouse av full length
(Plasmid #217809)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217809 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pD2529 CAG
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ITGAV
  • Alt name
    Integrin alpha V
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Itgav (a.k.a. 1110004F14Rik, 2610028E01Rik, CD51, D430040G12Rik)
  • Promoter CAG
  • Tag / Fusion Protein
    • P2A-EGFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTTCCTACAGCTCCTGGGCAAC
  • 3′ sequencing primer AACAGTTCTGCGCCCTTAGA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mouse av full length was a gift from Timothy Springer (Addgene plasmid # 217809 ; http://n2t.net/addgene:217809 ; RRID:Addgene_217809)

  • For your References section:

    Synthetic integrin antibodies discovered by yeast display reveal αV subunit pairing preferences with β subunits. Yuxin Hao, Jiabin Yan, Courtney Fraser, Aiping Jiang, Murali Anuganti, Roushu Zhang, Kenneth Lloyd, Joseph Jardine, Jessica Coppola, Rob Meijers, Jing Li, Timothy A.. bioRxiv 2024.01.26.577394 10.1101/2024.01.26.577394
Related items: