Skip to main content
Addgene

CRISPRoff-mScarletI
(Plasmid #217783)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217783 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    CRISPRoff-v2.1
  • Backbone manufacturer
    Luke Gilbert (Addgene plasmid # 167981)
  • Backbone size w/o insert (bp) 4836
  • Total vector size (bp) 11874
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRISPRoff-mScarletI (DNMT3A-DNMT3L-dCas9-mScarletI-KRAB)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    7041
  • Promoter CAG
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • mScarletI (C terminal on insert)
    • 2xNLS (C terminal on insert)
    • DNMT3A-DNMT3L (N terminal on insert)
    • KRAB (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggcaaagaattctgcagtcg
  • 3′ sequencing primer ccaccaccttctgataggc
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The plasmid was generated by replacing the BFP sequence with the mScarletI sequence originated from the addgene plasmid #85044.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CRISPRoff-mScarletI was a gift from Adriano Aguzzi (Addgene plasmid # 217783 ; http://n2t.net/addgene:217783 ; RRID:Addgene_217783)

  • For your References section:

    Arrayed CRISPR libraries for the genome-wide activation, deletion and silencing of human protein-coding genes. Yin JA, Frick L, Scheidmann MC, Liu T, Trevisan C, Dhingra A, Spinelli A, Wu Y, Yao L, Vena DL, Knapp B, Guo J, De Cecco E, Ging K, Armani A, Oakeley EJ, Nigsch F, Jenzer J, Haegele J, Pikusa M, Tager J, Rodriguez-Nieto S, Bouris V, Ribeiro R, Baroni F, Bedi MS, Berry S, Losa M, Hornemann S, Kampmann M, Pelkmans L, Hoepfner D, Heutink P, Aguzzi A. Nat Biomed Eng. 2024 Dec 4. doi: 10.1038/s41551-024-01278-4. 10.1038/s41551-024-01278-4 PubMed 39633028
Related items: