pSbi-pur-EGFP-KSR1-CA3 (N-KSR)
(Plasmid
#217769)
-
PurposeFluorescent reporter for glucosyl-ceramide (putative, mammalian expression)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4600
- Total vector size (bp) 4989
-
Vector typeMammalian Expression ; Sleeping Beauty Transposase-compatible genome insertion
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKinase suppressor of ras 1 CA3 domain
-
Alt nameKSR1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)321
-
MutationCA3 domain aa 317-400
-
GenBank IDXM_047436985
-
Entrez GeneKSR1 (a.k.a. KSR, RSU2)
- Promoter EF-1alpha promoter
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSbi-pur-EGFP-KSR1-CA3 (N-KSR) was a gift from Paula Nunes-Hasler (Addgene plasmid # 217769 ; http://n2t.net/addgene:217769 ; RRID:Addgene_217769) -
For your References section:
Development of Genetically Encoded Fluorescent KSR1-Based Probes to Track Ceramides during Phagocytosis. Girik V, van Ek L, Dentand Quadri I, Azam M, Cruz Cobo M, Mandavit M, Riezman I, Riezman H, Gavin AC, Nunes-Hasler P. Int J Mol Sci. 2024 Mar 5;25(5):2996. doi: 10.3390/ijms25052996. 10.3390/ijms25052996 PubMed 38474242