Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSbi-pur-KSR1-CA3-EGFP (C-KSR)
(Plasmid #217768)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 217768 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 4600
  • Total vector size (bp) 4978
  • Vector type
    Mammalian Expression ; Sleeping Beauty Transposase-compatible genome insertion
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kinase suppressor of ras 1 CA3 domain
  • Alt name
    KSR1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    321
  • Mutation
    CA3 domain aa 317-400 plus vector-based linker LELKLRILQS (contains autophagy sequence)
  • GenBank ID
    XM_047436985
  • Entrez Gene
    KSR1 (a.k.a. KSR, RSU2)
  • Promoter EF-1alpha promoter
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSbi-pur-KSR1-CA3-EGFP (C-KSR) was a gift from Paula Nunes-Hasler (Addgene plasmid # 217768 ; http://n2t.net/addgene:217768 ; RRID:Addgene_217768)
  • For your References section:

    Development of Genetically Encoded Fluorescent KSR1-Based Probes to Track Ceramides during Phagocytosis. Girik V, van Ek L, Dentand Quadri I, Azam M, Cruz Cobo M, Mandavit M, Riezman I, Riezman H, Gavin AC, Nunes-Hasler P. Int J Mol Sci. 2024 Mar 5;25(5):2996. doi: 10.3390/ijms25052996. 10.3390/ijms25052996 PubMed 38474242