YIPlac204TKC-DsRed-Express2-HDEL
(Plasmid #21770)

• Depositing Lab: Benjamin Glick
• Publication: Glick lab plasmids (unpublished)

Backbone

• Vector backbone: YIPlac204
• Backbone size w/o insert (bp): 4000
• Vector type: Yeast Expression
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: DsRed-Express2
• Alt name: DsRed
• Species: Discosoma sp.
• Insert Size (bp): 4985
• GenBank ID: FJ226077
• Tags / Fusion Proteins:
  • preKar2 (N terminal on insert)
  • HDEL (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CTACAAAAAACACATACATAAACT

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Linearize with EcoRV to direct integration at the TRP1 locus.

Addgene NGS confirms a single silent mutation within the DsRed-Express2 coding sequence compared to the reference sequence provided by the depositing laboratory