pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL
(Plasmid
#217676)
-
PurposeAAV-mediated, Cre-dependent co-expression of GtACR2 and soma-targeted Voltron2 (ORCHID) for assessing inhibitory receptor driving force through voltage imaging with concurrent activation of GtACR2.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217676 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4158
- Total vector size (bp) 6951
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGtACR2-P2A-Voltron2ST
-
Alt nameORCHID (all-Optical Reporting of CHloride Ion Driving force)
-
SpeciesSynthetic
-
Insert Size (bp)2793
- Promoter EF‐1α
-
Tag
/ Fusion Protein
- Soma targeting sequence (Kv2.1) on Voltron2 gene only. (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (unknown if destroyed)
- 3′ cloning site Nhe1 (unknown if destroyed)
- 5′ sequencing primer CTCCTCATGTCAATCACTCC; GTCCATGTATTCTTCGACCAG; GTGCAACATGCGGGATGATG; GTATGCGCTCTTCAGCTCTG; CAGCCACTTCATGTACTCGG
- 3′ sequencing primer GTAATCCAGAGGTTGATTATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe Voltron2-ST gene originates from pGP-pcDNA3.1 Puro-CAG-Voltron2-ST (Addgene #172910), and was kindly provided by Eric Schreiter and Ahmed Abdelfattah. The GtACR2 gene originates from pAAV-EF1α-FRT-FLEX-GtACR2-EYFP (Addgene #114369).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.08.30.555464v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL was a gift from Joseph Raimondo (Addgene plasmid # 217676 ; http://n2t.net/addgene:217676 ; RRID:Addgene_217676) -
For your References section:
All-optical reporting of inhibitory receptor driving force in the nervous system. Selfe JS, Steyn TJS, Shorer EF, Burman RJ, Düsterwald KM, Abdelfattah AS, Schreiter ER, Newey SE, Akerman CJ, Raimondo JV. bioRxiv 2023.08.30.555464 10.1101/2023.08.30.555464