RepairTemplate_AAVS1-OsTIR1-F74G-SNAP
(Plasmid
#217665)
-
PurposeRepair template to integrate OsTIR1-F74G-SNAP into the human AAVS1 safe harbour locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217665 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAddgene #129719
- Backbone size w/o insert (bp) 3438
- Total vector size (bp) 9424
-
Modifications to backboneThe plasmid was digested with HpaI and AflII; purified the fragment containing the HA-L & HA-R. Blunt-end clone OsTIR1-F74G-SNAP-Blast insert into the backbone
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOsTir1 F74G-SNAP-Blast-AAVS1
-
SpeciesO. sativa
-
Insert Size (bp)5986
-
Tag
/ Fusion Protein
- SNAP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAACACAGGACCGGTTCTAGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RepairTemplate_AAVS1-OsTIR1-F74G-SNAP was a gift from Daniel Gerlich (Addgene plasmid # 217665 ; http://n2t.net/addgene:217665 ; RRID:Addgene_217665) -
For your References section:
Cohesin-mediated DNA loop extrusion resolves sister chromatids in G2 phase. Batty P, Langer CC, Takacs Z, Tang W, Blaukopf C, Peters JM, Gerlich DW. EMBO J. 2023 Aug 15;42(16):e113475. doi: 10.15252/embj.2023113475. Epub 2023 Jun 26. 10.15252/embj.2023113475 PubMed 37357575