gRNA3_NIPBL_Cas9-hGem-for_N-terminal_tagging
(Plasmid #217662)

• Purpose: expresses Cas9-hGem and guideRNA for N terminal tagging of NIPBL
• Depositing Lab: Daniel Gerlich
• Publication: Batty et al EMBO J. 2023 Aug 15;42(16):e113475. doi: 10.15252/embj.2023113475. Epub 2023 Jun 26.

Backbone

• Vector backbone: pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem-Bpil-P2A-mCherry
• Backbone size w/o insert (bp): 9643
• Total vector size (bp): 9346
• Vector type: Mammalian Expression, Bacterial Expression, CRISPR
• Selectable markers: mCherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgRNA3 for N terminal tagging of NIPBL
• gRNA/shRNA sequence: caccgtgtccccattactactcttg
• Species: H. sapiens (human)
• Insert Size (bp): 20
• Entrez Gene: NIPBL (a.k.a. CDLS, CDLS1, IDN3, IDN3-B, Scc2)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: GACTATCATATGCTTACCGT
• 3′ sequencing primer: GATGGGGAGAGTGAAGCAGAAC

Resource Information

• Supplemental Documents:
  • Blaukopf_g2t_6_1875_pLann.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry