RepairTemplate_Smc4-mAID-HaloTAG
(Plasmid
#217658)
-
PurposeRepair template to endogenously tag SMC4 with mAID-Halo Tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217658 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCR2.1
- Backbone size w/o insert (bp) 3913
- Total vector size (bp) 6832
-
Modifications to backboneThe backbone was digested with EcoRV. Insert ordered as gBlock and blunt-end cloned into vector
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSMC4-mAID-HaloTag
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2918
-
Entrez GeneSMC4 (a.k.a. CAP-C, CAPC, SMC-4, SMC4L1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer CAGGAAACAGCTATGAC
- 3′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RepairTemplate_Smc4-mAID-HaloTAG was a gift from Daniel Gerlich (Addgene plasmid # 217658 ; http://n2t.net/addgene:217658 ; RRID:Addgene_217658) -
For your References section:
Cohesin-mediated DNA loop extrusion resolves sister chromatids in G2 phase. Batty P, Langer CC, Takacs Z, Tang W, Blaukopf C, Peters JM, Gerlich DW. EMBO J. 2023 Aug 15;42(16):e113475. doi: 10.15252/embj.2023113475. Epub 2023 Jun 26. 10.15252/embj.2023113475 PubMed 37357575