RepairTemplate_Smc4-mAID-HaloTAG
(Plasmid #217658)

• Purpose: Repair template to endogenously tag SMC4 with mAID-Halo Tag
• Depositing Lab: Daniel Gerlich
• Publication: Batty et al EMBO J. 2023 Aug 15;42(16):e113475. doi: 10.15252/embj.2023113475. Epub 2023 Jun 26.

Backbone

• Vector backbone: pCR2.1
• Backbone size w/o insert (bp): 3913
• Total vector size (bp): 6832
• Modifications to backbone: The backbone was digested with EcoRV. Insert ordered as gBlock and blunt-end cloned into vector
• Vector type: Mammalian Expression, Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SMC4-mAID-HaloTag
• Species: H. sapiens (human)
• Insert Size (bp): 2918
• Entrez Gene: SMC4 (a.k.a. CAP-C, CAPC, SMC-4, SMC4L1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (destroyed during cloning)
• 3′ cloning site: None (unknown if destroyed)
• 5′ sequencing primer: CAGGAAACAGCTATGAC
• 3′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Supplemental Documents:
  • Blaukopf_g2t_5_1792_pLann.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry