Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTRIPZ-shNTC
(Plasmid #217638)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217638 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTRIPZ
  • Backbone manufacturer
    Dharmacon # RHS4744
  • Vector type
    RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Bleocin (Zeocin), 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shNTC
  • gRNA/shRNA sequence
    TCTCGCTTGGGCGAGAGTAA
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIPZ-shNTC was a gift from Constanze Bonifer (Addgene plasmid # 217638 ; http://n2t.net/addgene:217638 ; RRID:Addgene_217638)
  • For your References section:

    Isoform-specific and signaling-dependent propagation of acute myeloid leukemia by Wilms tumor 1. Potluri S, Assi SA, Chin PS, Coleman DJL, Pickin A, Moriya S, Seki N, Heidenreich O, Cockerill PN, Bonifer C. Cell Rep. 2021 Apr 20;35(3):109010. doi: 10.1016/j.celrep.2021.109010. 10.1016/j.celrep.2021.109010 PubMed 33882316
Commonly requested with: