pTRIPZ-shWT1_A
(Plasmid
#217636)
-
PurposeDox inducible shRNA targeting WT-1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217636 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTRIPZ
-
Backbone manufacturerDharmacon # RHS4744
-
Vector typeRNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Bleocin (Zeocin), 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshWT1_A
-
gRNA/shRNA sequenceGGTGTTGATCTTACAAGATAT
-
SpeciesH. sapiens (human)
-
Entrez GeneWT1 (a.k.a. AWT1, GUD, NPHS4, WAGR, WIT-2, WT-1, WT33)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIPZ-shWT1_A was a gift from Constanze Bonifer (Addgene plasmid # 217636 ; http://n2t.net/addgene:217636 ; RRID:Addgene_217636) -
For your References section:
Isoform-specific and signaling-dependent propagation of acute myeloid leukemia by Wilms tumor 1. Potluri S, Assi SA, Chin PS, Coleman DJL, Pickin A, Moriya S, Seki N, Heidenreich O, Cockerill PN, Bonifer C. Cell Rep. 2021 Apr 20;35(3):109010. doi: 10.1016/j.celrep.2021.109010. 10.1016/j.celrep.2021.109010 PubMed 33882316