pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
(Plasmid #217635)

• Purpose: AAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.
• Depositing Lab: Martin Kampmann
• Publication: Scalable, cell type-selective in vivo AAV-based CRISPR screens in mice (unpublished)

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-U6- sgRNA-CMV-GFP (Addgene #85451)
• Backbone manufacturer: Hetian Lei
• Backbone size w/o insert (bp): 2904
• Total vector size (bp): 6016
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mU6-sgRNA, Handle sequence, EF1a-mTagBFP2
• gRNA/shRNA sequence: Non-targeting control in mouse genetic background (mNTC194): GGATGCATAGATGAACGGAT
• Species: Synthetic; mTagBFP2 derived from Entacmaea quadricolor
• Promoter: EF1alpha and mU6

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: oIR007: ccaactccatcactaggggttcct

Resource Information

• Supplemental Documents:
  • pap215-ntc194.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2023.06.13.544831 for bioRxiv preprint.