pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
(Plasmid #217635)

• Purpose: AAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.
• Depositing Lab: Martin Kampmann
• Publication: Scalable, cell type-selective in vivo AAV-based CRISPR screens in mice (unpublished)

Backbone

• Vector backbone: pAAV-U6- sgRNA-CMV-GFP (Addgene #85451)
• Backbone manufacturer: Hetian Lei
• Backbone size w/o insert (bp): 2904
• Total vector size (bp): 6016
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mU6-sgRNA, Handle sequence, EF1a-mTagBFP2
• gRNA/shRNA sequence: Non-targeting control in mouse genetic background (mNTC194): GGATGCATAGATGAACGGAT
• Species: Synthetic; mTagBFP2 derived from Entacmaea quadricolor
• Promoter: EF1alpha and mU6

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: oIR007: ccaactccatcactaggggttcct

Resource Information

• Supplemental Documents:
  • pap215-ntc194.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2023.06.13.544831 for bioRxiv preprint.