Skip to main content
Addgene

pAAV-TetON-CD4
(Plasmid #217537)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217537 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD4 receptor
  • Species
    H. sapiens (human)
  • Entrez Gene
    CD4 (a.k.a. CD4mut, IMD79, Leu-3, OKT4D, T4)
  • Promoter TetOperon (TetO)
  • Tag / Fusion Protein
    • HA epitope (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site SphI (not destroyed)
  • 5′ sequencing primer CACCACGCGAGGCGCGAGATA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-TetON-CD4 was a gift from Peter Scheiffele (Addgene plasmid # 217537 ; http://n2t.net/addgene:217537 ; RRID:Addgene_217537)

  • For your References section:

    Control of neuronal excitation-inhibition balance by BMP-SMAD1 signaling. Okur Z, Schlauri N, Bitsikas V, Panopoulou M, Karmakar K, Schreiner D, Scheiffele P. bioRxiv 2023 10.1101/2023.03.11.532164
Related items:
Commonly requested with: