pAAV-2xflox-BRX-eGFP-NLS
(Plasmid #217535)

• Purpose: AAV vector to drive the expression of eGFP in genetically defined cell populations under the control of the 4xBRE regulatory element of SMAD1 transcription factor and miniXon splicing casette in vivo
• Depositing Lab: Peter Scheiffele
• Publication: Okur et al bioRxiv 2023

Backbone

• Vector backbone: pAAV
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 4X BRE reporter and miniXon casette
• Species: M. musculus (mouse)
• Entrez Gene: Smad1 (a.k.a. Mad1, Madh1, Madr1, Mlp1, MusMLP, dwf-A, mMad1)
• Promoter: BMP response element (BRE)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: MluI (destroyed during cloning)
• 5′ sequencing primer: CTAGCAAAATAGGCTGTCC
• 3′ sequencing primer: cgctatgtggatacgctgct

Resource Information

• Supplemental Documents:
  • pAAV-2xflox-4xBRE-GFP-NLS.annotation.gb
• A portion of this plasmid was derived from a plasmid made by: https://addgene.org/67811/ plasmid was used to clone BRE sequence. https://www.addgene.org/174660/ plasmid was used to clone miniXon casette.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry