pAAV-BRX-eGFP-NLS
(Plasmid #217534)

• Purpose: AAV vector to drive the expression of eGFP under the control of the 4xBRE regulatory element of SMAD1 and miniXon splicing casette transcription factor in vivo
• Depositing Lab: Peter Scheiffele
• Publication: Okur et al bioRxiv 2023

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BMP reporter element and miniXon casette
• Species: M. musculus (mouse)
• Entrez Gene: Smad1 (a.k.a. Mad1, Madh1, Madr1, Mlp1, MusMLP, dwf-A, mMad1)
• Promoter: BMP Reporter Element

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (destroyed during cloning)
• 3′ cloning site: AscI (destroyed during cloning)
• 5′ sequencing primer: CTAGCAAAATAGGCTGTCC
• 3′ sequencing primer: cgctatgtggatacgctgct

Resource Information

• Supplemental Documents:
  • pAAV-4xBRE-GFP-NLS.annotation.gb
• A portion of this plasmid was derived from a plasmid made by: addgene.org/67811/ plasmid was used to clone BRE element. https://www.addgene.org/174660/ plasmid was used to clone miniXon casette.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry