Skip to main content
Addgene

pAAV-BRX-eGFP-NLS
(Plasmid #217534)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217534 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BMP reporter element and miniXon casette
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Smad1 (a.k.a. Mad1, Madh1, Madr1, Mlp1, MusMLP, dwf-A, mMad1)
  • Promoter BMP Reporter Element

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site AscI (destroyed during cloning)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCC
  • 3′ sequencing primer cgctatgtggatacgctgct
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    addgene.org/67811/ plasmid was used to clone BRE element. https://www.addgene.org/174660/ plasmid was used to clone miniXon casette.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-BRX-eGFP-NLS was a gift from Peter Scheiffele (Addgene plasmid # 217534 ; http://n2t.net/addgene:217534 ; RRID:Addgene_217534)

  • For your References section:

    Control of neuronal excitation-inhibition balance by BMP-SMAD1 signaling. Okur Z, Schlauri N, Bitsikas V, Panopoulou M, Karmakar K, Schreiner D, Scheiffele P. bioRxiv 2023 10.1101/2023.03.11.532164
Related items: