pAAV-S5E2-FingR-PSD95-mGL
(Plasmid #217533)

• Purpose: Genetically encoded fluorescent probe for labelling endogenous excitatory synapses on PV interneurons in vivo
• Depositing Lab: Peter Scheiffele
• Publication: Okur et al bioRxiv 2023

Backbone

• Vector backbone: pAAV
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ZnF-FingR-PSD95-mGreenLantern
• Species: M. musculus (mouse)
• Entrez Gene: Dlg4 (a.k.a. Dlgh4, PSD-95, PSD95, SAP90, SAP90A)
• Promoter: S5E2 enhancer
• Tag / Fusion Protein:
  • mGreenLantern (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: AscI (unknown if destroyed)
• 5′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG
• 3′ sequencing primer: cgctatgtggatacgctgct

Resource Information

• Supplemental Documents:
  • pAAV-S5E2-FingR-PSD95.annotation.gb
• A portion of this plasmid was derived from a plasmid made by: https://www.addgene.org/135630/ was used as backbone for cloning.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry