miniCMV-tdTomato-tDeg
(Plasmid
#217521)
-
PurposeExpresses tdTomato-tDeg fluorogenic protein in mammalian cells with miniCMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217521 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 1581
- Total vector size (bp) 6362
-
Vector typeMammalian Expression
-
Selectable markersNo other marker
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsNo additional growing instructions
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametdTomato-tDeg fluorogenic protein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1581
- Promoter miniCMV
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
miniCMV-tdTomato-tDeg was a gift from Xing Li (Addgene plasmid # 217521 ; http://n2t.net/addgene:217521 ; RRID:Addgene_217521) -
For your References section:
Fluorogenic CRISPR for genomic DNA imaging. Zhang Z, Rong X, Xie T, Li Z, Song H, Zhen S, Wang H, Wu J, Jaffrey SR, Li X. Nat Commun. 2024 Jan 31;15(1):934. doi: 10.1038/s41467-024-45163-9. 10.1038/s41467-024-45163-9 PubMed 38296979