MS-1 magA
(Plasmid #21751)

• Depositing Lab: Elliot Meyerowitz
• Publication: Bertani et al Gene. 2001 Feb 21. 264(2):257-63.

Backbone

• Vector backbone: pCR2.1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 3900
• Vector type: cloning

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: magA
• Species: M. magnetotacticum
• Insert Size (bp): 1300
• GenBank ID: AF257521
• Entrez Gene: magA

Cloning Information

• Cloning method: TOPO Cloning
• 5′ cloning site: TA (destroyed during cloning)
• 3′ cloning site: TA (destroyed during cloning)
• 5′ sequencing primer: GAAGACGGCCATCTTCACCA
• 3′ sequencing primer: TTCTTCCAGATGAACTTGAA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The sequence inserted into the pCR2.1 vector is larger than just the magA gene. The magA gene is preceded by 373 bp of genomic DNA and followed by 30 bp of genomic DNA. The gene contains 2 amino acid substitutions - S94L and P390S.

The cloned gene was used primarily as a probe. Also see Zurkiya et al. Magn Reson Med. 2008 Jun;59(6):1225-31.