pSM045
(Plasmid
#217399)
-
PurposeKmR, pBTRcK broad host range vector with BTE1(C12-specific fatty acid thioesterase codon-optimised for C. necator) under Ptrc
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217399 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBTrcK
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 5403
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBTE1
-
Alt nameBTE
-
SpeciesSynthetic
-
Insert Size (bp)906
- Promoter PTrc
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGAAACAGACCATTAGGAGG
- 3′ sequencing primer TCTCTCATCCGCCAAAACAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSM045 was a gift from Brian Pfleger (Addgene plasmid # 217399 ; http://n2t.net/addgene:217399 ; RRID:Addgene_217399) -
For your References section:
Expanding the synthetic biology toolbox of Cupriavidus necator for establishing fatty acid production. Mishra S, Perkovich PM, Mitchell WP, Venkataraman M, Pfleger B. J Ind Microbiol Biotechnol. 2024 Feb 16:kuae008. doi: 10.1093/jimb/kuae008. 10.1093/jimb/kuae008 PubMed 38366943