pAAV-hSyn-frt-DIO-hM4D(Gi)-mCherry
(Plasmid #217398)

• Purpose: Expresses the hM4D(Gi) inhibitory DREADD fused to mCherry, in a Cre-ON and FLP-OFF dependent manner, under the control of hSyn promoter
• Depositing Lab: Oscar Marin
• Publication: Somatostatin interneurons control the timing of developmental desynchronization in cortical networks (unpublished)

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4923
• Total vector size (bp): 7098
• Modifications to backbone: Modified from Addgene Plasmid #44362 by inserting FRT sites around the DIO casette between KpnI-SalI and EcoRI-HindIII
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hM4D(Gi)-mCherry
• Species: H. sapiens (human)
• Insert Size (bp): 2175
• Promoter: human Synapsin 1
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Asc I (not destroyed)
• 3′ cloning site: Nhe I (not destroyed)
• 5′ sequencing primer: tcgtgtcgtgcctgagagcg
• 3′ sequencing primer: GCATTAAAGCAGCGTATCCACATAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene Plasmid #44362

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry