pAAV-ITR-EcYtR(NGS-6)-mCherry
(Plasmid
#217363)
-
PurposeExpresses E. coli tyrosine tRNA variant "NGS-6" and a wild-type mCherry reporter; can be packaged into AAV
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-ITR-mCherry
- Backbone size w/o insert (bp) 5486
- Total vector size (bp) 5852
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE. coli tyrosine tRNA mutant, "NGS-6"
-
Alt nameEcYtR-NGS-6
-
Alt nameYtR-NGS-6
-
SpeciesEscherichia coli
-
Insert Size (bp)354
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CTGCGGCCGCACGCGTCTCGCGGTCCAG
- 3′ sequencing primer GCTGCTCTCGTCGATCCGCTAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-ITR-EcYtR(NGS-6)-mCherry was a gift from Abhishek Chatterjee (Addgene plasmid # 217363 ; http://n2t.net/addgene:217363 ; RRID:Addgene_217363) -
For your References section:
Virus-assisted directed evolution of enhanced suppressor tRNAs in mammalian cells. Jewel D, Kelemen RE, Huang RL, Zhu Z, Sundaresh B, Cao X, Malley K, Huang Z, Pasha M, Anthony J, van Opijnen T, Chatterjee A. Nat Methods. 2023 Jan;20(1):95-103. doi: 10.1038/s41592-022-01706-w. Epub 2022 Dec 22. 10.1038/s41592-022-01706-w PubMed 36550276