pAcBac1-GFP(39TAG)
(Plasmid #217360)

• Purpose: Expression of reporter EGFP with a TAG stop codon at 39 aa position; can be packaged into bacmid
• Depositing Lab: Abhishek Chatterjee
• Publication: Jewel et al Nat Methods. 2023 Jan;20(1):95-103. doi: 10.1038/s41592-022-01706-w. Epub 2022 Dec 22.

Backbone

• Vector backbone: pAcBac1-EGFP
• Backbone manufacturer: derived from pFastBac-Dual from Invitrogen.
• Backbone size w/o insert (bp): 7942
• Total vector size (bp): 8755
• Modifications to backbone: replaced eGFP wild type with eGFP-Y39TAG from overlap PCR using restriction enzymes EcoRI and NheI
• Vector type: Mammalian Expression, Insect Expression ; baculoviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Gentamicin, 100 & 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Enhanced green fluorescent protein
• Alt name: eGFP
• Alt name: eGFP-Y39TAG
• Alt name: GFP(39TAG)
• Insert Size (bp): 782
• Mutation: Y39TAG
• GenBank ID: 8382257
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CAAGGAGGAGAAAATGAAAGCCATACGG

Resource Information

• Supplemental Documents:
  • pacbac1-gfp39tag.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

the 39 amino acid position for Y39TAG is relative to the fully processed eGFP (i.e. the numbering for amino acid position starts after the methionine start codon that is removed from eGFP post-translationally).