Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAcBac1-GFP(39TAG)
(Plasmid #217360)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217360 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAcBac1-EGFP
  • Backbone manufacturer
    derived from pFastBac-Dual from Invitrogen.
  • Backbone size w/o insert (bp) 7942
  • Total vector size (bp) 8755
  • Modifications to backbone
    replaced eGFP wild type with eGFP-Y39TAG from overlap PCR using restriction enzymes EcoRI and NheI
  • Vector type
    Mammalian Expression, Insect Expression ; baculoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Gentamicin, 100 & 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Enhanced green fluorescent protein
  • Alt name
    eGFP
  • Alt name
    eGFP-Y39TAG
  • Alt name
    GFP(39TAG)
  • Insert Size (bp)
    782
  • Mutation
    Y39TAG
  • GenBank ID
    8382257
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAAGGAGGAGAAAATGAAAGCCATACGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

the 39 amino acid position for Y39TAG is relative to the fully processed eGFP (i.e. the numbering for amino acid position starts after the methionine start codon that is removed from eGFP post-translationally).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAcBac1-GFP(39TAG) was a gift from Abhishek Chatterjee (Addgene plasmid # 217360 ; http://n2t.net/addgene:217360 ; RRID:Addgene_217360)
  • For your References section:

    Virus-assisted directed evolution of enhanced suppressor tRNAs in mammalian cells. Jewel D, Kelemen RE, Huang RL, Zhu Z, Sundaresh B, Cao X, Malley K, Huang Z, Pasha M, Anthony J, van Opijnen T, Chatterjee A. Nat Methods. 2023 Jan;20(1):95-103. doi: 10.1038/s41592-022-01706-w. Epub 2022 Dec 22. 10.1038/s41592-022-01706-w PubMed 36550276