pHR Ef1a-dCas9-BFP-KRAB
(Plasmid
#217304)
-
Purposelentiviral vector for dCas9-BFP-KRAB on Ef1alpha promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217304 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR
- Total vector size (bp) 14820
-
Vector typeLentiviral, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-tagBFP-KRAB
-
SpeciesSynthetic
- Promoter Ef1alpha
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GTGCCCGTCAGTGGGCAGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR Ef1a-dCas9-BFP-KRAB was a gift from Luke Gilbert (Addgene plasmid # 217304 ; http://n2t.net/addgene:217304 ; RRID:Addgene_217304)