-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21718 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDsRed-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4000
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDsRed-Max
-
SpeciesDiscosoma sp.
-
Insert Size (bp)678
-
GenBank IDFJ226078
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cggactcagatctcgagctcaagc (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDsRed-Max-N1 was a gift from Benjamin Glick (Addgene plasmid # 21718 ; http://n2t.net/addgene:21718 ; RRID:Addgene_21718) -
For your References section:
A noncytotoxic DsRed variant for whole-cell labeling. Strack RL, Strongin DE, Bhattacharyya D, Tao W, Berman A, Broxmeyer HE, Keenan RJ, Glick BS. Nat Methods. 2008 Nov . 5(11):955-7. 10.1038/nmeth.1264 PubMed 18953349