pBAD-mNectarine
(Plasmid #21717)

• Purpose: Bacterial expression of pH-sensitive monomeric mNectarine red fluorescent protein
• Depositing Lab: Robert Campbell
• Publication: Johnson et al J Biol Chem. 2009 Jul 31;284(31):20499-511. doi: 10.1074/jbc.M109.019042.

Backbone

• Vector backbone: pBad/His B
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4100
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mNectarine fluorescent proteins
• Alt name: Synthetic construct fluorescent protein mNectarine gene
• Species: evolved fluorescent protein
• Insert Size (bp): 720
• Mutation: The fluorescent protein was inserted between XhoI and EcoR1 of pBad/His B. There is an extra 'C' after XhoI to avoid the frameshift.
• GenBank ID: FJ439505
• Tag / Fusion Protein:
  • His (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry