Skip to main content
Addgene

pEGFP-hTimeless (pc4729)
(Plasmid #216861)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216861 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pENeGFPRPA34 (pc624)
  • Total vector size (bp) 5208
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Timeless
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3628
  • Entrez Gene
    TIMELESS (a.k.a. FASPS4, TIM, TIM1, hTIM)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-hTimeless (pc4729) was a gift from Cristina Cardoso (Addgene plasmid # 216861 ; http://n2t.net/addgene:216861 ; RRID:Addgene_216861)
  • For your References section:

    Timeless-Tipin interactions with MCM and RPA mediate DNA replication stress response. Prorok P, Wolf E, Cardoso MC. Front Cell Dev Biol. 2024 Feb 29;12:1346534. doi: 10.3389/fcell.2024.1346534. eCollection 2024. 10.3389/fcell.2024.1346534 PubMed 38487270