Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CIRTS-FTO-control
(Plasmid #216859)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216859 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFsy(1.1)GW
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 9801
  • Total vector size (bp) 13297
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CIRTS-FTO-Calm3-U6-control gRNA
  • Species
    H. sapiens (human), M. musculus (mouse), Synthetic
  • Insert Size (bp)
    4223
  • Promoter Syn1, U6
  • Tag / Fusion Protein
    • mCherry2 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer Syn1 Forward CCACAAGAGGTGCAAGATAGG
  • 3′ sequencing primer WPRE-R CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The CIRTS PIN nuclease construct was a kind gift from Professor Bryan Dickinson.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CIRTS-FTO-control was a gift from Timothy Bredy (Addgene plasmid # 216859 ; http://n2t.net/addgene:216859 ; RRID:Addgene_216859)
  • For your References section:

    Synapse-Enriched m(6)A-Modified Malat1 Interacts with the Novel m(6)A Reader, DPYSL2, and Is Required for Fear-Extinction Memory. Madugalle SU, Liau WS, Zhao Q, Li X, Gong H, Marshall PR, Periyakaruppiah A, Zajaczkowski EL, Leighton LJ, Ren H, Musgrove MRB, Davies JWA, Kim G, Rauch S, He C, Dickinson BC, Fulopova B, Fletcher LN, Williams SR, Spitale RC, Bredy TW. J Neurosci. 2023 Oct 25;43(43):7084-7100. doi: 10.1523/JNEUROSCI.0943-23.2023. Epub 2023 Sep 5. 10.1523/JNEUROSCI.0943-23.2023 PubMed 37669863