CIRTS-FTO-control
(Plasmid #216859)

• Purpose: CIRTS RNA targeting system for targeted removal of m6A on transcript at the synapse. CIRTS-FTO-Calm3 and scramble gRNA is expressed under human Syn1 and U6 promoter, respectively.
• Depositing Lab: Timothy Bredy
• Publication: Madugalle et al J Neurosci. 2023 Oct 25;43(43):7084-7100. doi: 10.1523/JNEUROSCI.0943-23.2023. Epub 2023 Sep 5.

Backbone

• Vector backbone: pFsy(1.1)GW
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 9801
• Total vector size (bp): 13297
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CIRTS-FTO-Calm3-U6-control gRNA
• Species: H. sapiens (human), M. musculus (mouse), Synthetic
• Insert Size (bp): 4223
• Promoter: Syn1, U6
• Tag / Fusion Protein:
  • mCherry2 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: Syn1 Forward CCACAAGAGGTGCAAGATAGG
• 3′ sequencing primer: WPRE-R CATAGCGTAAAAGGAGCAACA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The CIRTS PIN nuclease construct was a kind gift from Professor Bryan Dickinson.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry