AAV-U6-PALMDgRNA1+2-cTnT-Cre -mi122TS
(Plasmid
#216830)
-
Purposecardiomyocytes-specific plasmid, expressing gRNAs targeting Palmd exon7, containing a mi122TS sequence to decrease off-target effects in the liver.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 216830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-cTNT-Cre-miR122TS
- Backbone size w/o insert (bp) 6051
- Total vector size (bp) 6045
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePALMDgRNA
-
gRNA/shRNA sequenceGAGGCCGTCGGTGCCATTGT
-
SpeciesSynthetic
-
Insert Size (bp)87
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer gccgcacgcgccggtaccgagggcctatttcccatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.12.06.570334 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-U6-PALMDgRNA1+2-cTnT-Cre -mi122TS was a gift from Yuxuan Guo (Addgene plasmid # 216830 ; http://n2t.net/addgene:216830 ; RRID:Addgene_216830) -
For your References section:
In vivo proximity proteomics uncovers palmdelphin (PALMD) as a Z-disc-associated mitigator of isoproterenol-induced cardiac injury. Guo CT, Jardin BD, Lin JS, Ambroise RL, Wang Z, Yang LZ, Mazumdar N, Lu FJ, Ma Q, Cao YP, Liu CZ, Li KL, Liu XJ, Lan F, Zhao MM, Xiao H, Dong ED, Pu WT, Guo YX. Acta Pharmacol Sin. 2024 Jul 23. doi: 10.1038/s41401-024-01348-y. 10.1038/s41401-024-01348-y PubMed 39043970