hSirt3-RFP
(Plasmid #216806)

• Purpose: Human Sirt3-RFP driven by the CaMKII promoter
• Depositing Lab: Ghazaleh Ashrafi
• Publication: Tiwari et al J Cell Biol. 2024 Jan 1;223(1):e202305048. doi: 10.1083/jcb.202305048. Epub 2023 Nov 21.

Backbone

• Vector backbone: pFCK(1.3)GW
• Backbone size w/o insert (bp): 9239
• Total vector size (bp): 11141
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Zeocin ; bleomycin and phleomycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Sirt3
• Alt name: sirtuin 3
• Alt name: NAD-dependent protein deacetylase sirtuin-3
• Species: H. sapiens (human)
• Insert Size (bp): 1902
• GenBank ID:
• Entrez Gene: SIRT3 (a.k.a. SIR2L3)
• Promoter: CamKII
• Tag / Fusion Protein:
  • mRFP1 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: Age1 (not destroyed)
• 5′ sequencing primer: GAGGCTGTGAGCAGCCACAG
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry