T7_CC_PEmax_IVT_Template
(Plasmid #216793)

• Purpose: Template for in vitro transcription of PEmax.
• Depositing Lab: Daniel Bauer
• Publication: Levesque et al Nat Biotechnol. 2024 May 28. doi: 10.1038/s41587-024-02266-4.

Backbone

• Vector backbone: pBR322
• Total vector size (bp): 10184
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PEmax
• Insert Size (bp): 6396
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pT7_CC_PEmax_IVT_Template.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The vector should be linearized with BbsI prior to in vitro transcription. The vector has been designed for co-transcriptional capping with CleanCap AG. The vector encodes for a T7 promoter, a minimal 5’-UTR, a PEmax cassette harboring a silent mutation disrupting a restriction site for the linearizing BbsI enzyme, a 2x HBB 3’ UTR, and a poly(A) sequence. The poly(A) tail is 80-90 nucleotides long, as determined by restriction digestion. Poly(A) tail length should be assessed via restriction digestion after each step of transformation or cloning to avoid Poly(A) tail shortening.