T7_CC_Vpx-SIV_WPRE_IVT_Template
(Plasmid #216792)

• Purpose: Template for in vitro transcription of Vpx (SIV).
• Depositing Lab: Daniel Bauer
• Publication: Levesque et al Nat Biotechnol. 2024 May 28. doi: 10.1038/s41587-024-02266-4.

Backbone

• Vector backbone: pBR322
• Total vector size (bp): 4179
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Vpx (SIV)
• Species: H. sapiens (human)
• Insert Size (bp): 342
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CAGGAAACAGCTATGAC

Resource Information

• Supplemental Documents:
  • pT7_CC_Vpx-SIV_WPRE_IVT_Template.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Derived from pT7-PEmax for IVT (Addgene 178113). The template must be amplified by PCR using a forward primer designed to rectify a T7 promoter inactivating mutation and a reverse primer that appends a poly(A) tail to the 3’ UTR. The vector has been designed for co-transcriptional capping with CleanCap AG.