Skip to main content
Addgene

pAAV/hSyn-SCLM
(Plasmid #216760)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 216760 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV Syn ChR E90R-D156N-T159C 2A tDimer
  • Backbone manufacturer
    Thomas Oertner (Addgene plasmid # 52494)
  • Backbone size w/o insert (bp) 4690
  • Total vector size (bp) 6076
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SuperClomeleon
  • Alt name
    Cerulean/S30R/dC11-LE-Topaz/dN5/S30R/Q69T/V163A
  • Species
    A. victoria (crystal jelly)
  • Insert Size (bp)
    1386
  • Mutation
    S30R and 11 AA deletion in the Cerulean CFP moiety and 5 AA deletion, S30R, Q69T, and V163A in the Topaz YFP moiety
  • Promoter hSyn (human synapsin I)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer tgggcagcggaggagtcgt
  • 3′ sequencing primer agccatacgggaagcaatagc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Wimmer, R., Schmitt, L., Davidson, T. et al. Thalamic control of sensory selection in divided attention. Nature 526, 705–709 (2015). https://doi.org/10.1038/nature15398

Boffi JC, Knabbe J, Kaiser M and Kuner T (2018) KCC2-dependent Steady-state Intracellular Chloride Concentration and pH in Cortical Layer 2/3 Neurons of Anesthetized and Awake Mice. Front. Cell. Neurosci. 12:7. https://doi.org/10.3389/fncel.2018.00007

Nakajima M, Schmitt LI, Halassa MM. Prefrontal Cortex Regulates Sensory Filtering through a Basal Ganglia-to-Thalamus Pathway. Neuron 103(3), 445-458.e10 (2019). https://doi.org/10.1016/j.neuron.2019.05.026

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV/hSyn-SCLM was a gift from George Augustine (Addgene plasmid # 216760 ; http://n2t.net/addgene:216760 ; RRID:Addgene_216760)
Related items: