pAAV/hSyn-SCLM
(Plasmid #216760)

• Purpose: AAV2 transfer vector with the human synapsin I promoter for neuronal expression of SuperClomeleon
• Depositing Lab: George Augustine
• Publication: AAV2 transfer vectors for a genetically encoded chloride indicator, SuperClomeleon (unpublished)

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV Syn ChR E90R-D156N-T159C 2A tDimer
• Backbone manufacturer: Thomas Oertner (Addgene plasmid # 52494)
• Backbone size w/o insert (bp): 4690
• Total vector size (bp): 6076
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SuperClomeleon
• Alt name: Cerulean/S30R/dC11-LE-Topaz/dN5/S30R/Q69T/V163A
• Species: A. victoria (crystal jelly)
• Insert Size (bp): 1386
• Mutation: S30R and 11 AA deletion in the Cerulean CFP moiety and 5 AA deletion, S30R, Q69T, and V163A in the Topaz YFP moiety
• Promoter: hSyn (human synapsin I)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: tgggcagcggaggagtcgt
• 3′ sequencing primer: agccatacgggaagcaatagc

Resource Information

• Supplemental Documents:
  • pAAV_hSyn-SCLM.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Wimmer, R., Schmitt, L., Davidson, T. et al. Thalamic control of sensory selection in divided attention. Nature 526, 705–709 (2015). https://doi.org/10.1038/nature15398

Boffi JC, Knabbe J, Kaiser M and Kuner T (2018) KCC2-dependent Steady-state Intracellular Chloride Concentration and pH in Cortical Layer 2/3 Neurons of Anesthetized and Awake Mice. Front. Cell. Neurosci. 12:7. https://doi.org/10.3389/fncel.2018.00007

Nakajima M, Schmitt LI, Halassa MM. Prefrontal Cortex Regulates Sensory Filtering through a Basal Ganglia-to-Thalamus Pathway. Neuron 103(3), 445-458.e10 (2019). https://doi.org/10.1016/j.neuron.2019.05.026